si:dkey-201c13.4

Ensembl ID:
ENSDARG00000039181
ZFIN ID:
ZDB-GENE-060531-95
Description:
Novel protein similar to vertebrate transient receptor potential cation channel, subfamily M, member
Human Orthologue:
TRPM3
Human Description:
transient receptor potential cation channel, subfamily M, member 3 [Source:HGNC Symbol;Acc:17992]
Mouse Orthologue:
Trpm3
Mouse Description:
transient receptor potential cation channel, subfamily M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20416 Nonsense Available for shipment Available now
sa14345 Essential Splice Site Available for shipment Available now
sa6977 Nonsense Mutation detected in F1 DNA During 2017
sa18207 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Nonsense 421 1662 9 24
ENSDART00000147188 Nonsense 421 1734 9 26
Genomic Location (Zv9):
Chromosome 5 (position 27671086)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25426384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGAGTTGACATCGCCCGGAGCCAGATCTTCATTTACGGACAGCAGTG[G/A]CCTGTAGGCAATATCCACTCACACAAACCCAGTGCCTTGAAGTGACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Essential Splice Site 639 1662 14 24
ENSDART00000147188 Essential Splice Site 639 1734 14 26
Genomic Location (Zv9):
Chromosome 5 (position 27680879)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25436177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAACGRCATGGTCGATGACATTTCACAGGAGCTCAATCAAAACTCAAG[G/A]TAAGAATGTAAAGCTGTGTTATGACCTGCATGCTTTTCACCTGGATTYCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Nonsense 902 1662 19 24
ENSDART00000147188 Nonsense 972 1734 21 26
Genomic Location (Zv9):
Chromosome 5 (position 27697868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25453166
KASP Assay ID:
554-4426.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCTCRTGGCCATCCTCATCTTCTCCATYGGGATGGTGCTTCGTCTG[C/T]AGGMCCCGCCGCTGATGAGCTACGGCAGGGTCATTTACTGCGTCAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Nonsense 924 1662 19 24
ENSDART00000147188 Nonsense 994 1734 21 26
Genomic Location (Zv9):
Chromosome 5 (position 27697934)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25453232
KASP Assay ID:
2259-5827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTACGGCAGGGTCATTTACTGYGTCAATATCATTTATTGGTACATA[C/T]GACTCCTCGACATCTTCGGAGTGAAYAAATACCTGGGTCCRTAYGTCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link