rheb

Ensembl ID:
ENSDARG00000039162
ZFIN ID:
ZDB-GENE-000510-1
Description:
ras homolog enriched in brain [Source:RefSeq peptide;Acc:NP_001070216]
Human Orthologue:
RHEBL1
Human Description:
Ras homolog enriched in brain like 1 [Source:HGNC Symbol;Acc:21166]
Mouse Orthologue:
Rhebl1
Mouse Description:
Ras homolog enriched in brain like 1 Gene [Source:MGI Symbol;Acc:MGI:1916409]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13338 Splice Site, Nonsense Available for shipment Available now
sa20694 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057223 Splice Site, Nonsense 111 184 5 8

The following transcripts of ENSDARG00000039162 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 23377048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTGTGCAGGTTCTTCACGAMAAGCTTCTTGATATGGTTGGAAAGATA[C/T]AGTAAGTRTGGGTTGAACATATGGTCAAAATTATTACATGGGGCAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057223 Essential Splice Site 154 184 None 8

The following transcripts of ENSDARG00000039162 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 23377935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCCTGGGGTGCTGCTTTTATGGAGTCATCTGCGAAGGAAAATCAGG[T/C]ATAATAAACTTTTGTTTTTGGTAGCTTCAATTTATTTTTACAAAACGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyflm740