lgmn

Ensembl ID:
ENSDARG00000039150
ZFIN ID:
ZDB-GENE-021030-1
Description:
legumain [Source:RefSeq peptide;Acc:NP_999924]
Human Orthologue:
LGMN
Human Description:
legumain [Source:HGNC Symbol;Acc:9472]
Mouse Orthologue:
Lgmn
Mouse Description:
legumain Gene [Source:MGI Symbol;Acc:MGI:1330838]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22350 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22350
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057192 Nonsense 53 438 2 13
ENSDART00000134955 Nonsense 53 253 3 9
ENSDART00000139087 Nonsense 53 438 3 14
Genomic Location:
Chromosome 13 (position 36450308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGCTATGAATTTTTTTATTTATGTGTGTGCGTAGGCTGATGTGTG[C/A]CATGCGTATCAGATTGTCCATAAGAATGGGATTCCTGATGAGCAGATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lmesjs42