Q1RLR1_DANRE

Ensembl ID:
ENSDARG00000039145
Description:
LOC100008445 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLR1]
Human Orthologue:
PLAU
Human Description:
plasminogen activator, urokinase [Source:HGNC Symbol;Acc:9052]
Mouse Orthologue:
Plau
Mouse Description:
plasminogen activator, urokinase Gene [Source:MGI Symbol;Acc:MGI:97611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11884 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057179 Nonsense 242 430 8 11
Genomic Location (Zv9):
Chromosome 12 (position 47830199)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46762009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAGRGCTCAGACTCTTGTCCATAAACTCTCAGTGGTTCTGGGAAAG[A/T]AGGCCATAAAYGAGAMGGATGTTCAGAGCGAGCAGGAGTTCAGGGTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link