cox16

Ensembl ID:
ENSDARG00000039136
ZFIN ID:
ZDB-GENE-050417-60
Description:
COX16 cytochrome c oxidase assembly homolog [Source:RefSeq peptide;Acc:NP_001017594]
Human Orthologue:
COX16
Human Description:
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20213]
Mouse Orthologue:
AC132391.1
Mouse Description:
Cytochrome c oxidase assembly protein COX16 homolog, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6323 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35554 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057164 Essential Splice Site 47 107 2 4
Genomic Location (Zv9):
Chromosome 13 (position 36720459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36193028
KASP Assay ID:
554-4486.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGAATTCACTCAGATTAGATATGATGCTCAGAAGATCCAAAGAAAG[G/A]TAAGTGAAAGTATTGAGGTAAAGTTGATTTAATATTCGTTAGTTTTNGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057164 Essential Splice Site 48 107 3 4
Genomic Location (Zv9):
Chromosome 13 (position 36718958)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36191527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAATATTTTTTTCTTTTTATCCTTTGGTTGATTTTGGTGTTAAATTTA[G/T]CTGGACCCGGCACTGGAAGCCAGAGTGAAGAGTCAGAAACAGTCTGTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link