cox16

Ensembl ID:
ENSDARG00000039136
ZFIN ID:
ZDB-GENE-050417-60
Description:
COX16 cytochrome c oxidase assembly homolog [Source:RefSeq peptide;Acc:NP_001017594]
Human Orthologue:
COX16
Human Description:
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20213]
Mouse Orthologue:
AC132391.1
Mouse Description:
Cytochrome c oxidase assembly protein COX16 homolog, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6323 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057164 Essential Splice Site 47 107 2 4
Genomic Location:
Chromosome 13 (position 36720459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGAATTCACTCAGATTAGATATGATGCTCAGAAGATCCAAAGAAAG[G/A]TAAGTGAAAGTATTGAGGTAAAGTTGATTTAATATTCGTTAGTTTTNGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0716fue6