lamb4

Ensembl ID:
ENSDARG00000039133
ZFIN IDs:
ZDB-GENE-021226-2, ZDB-GENE-021226-2
Description:
Laminin subunit beta-4 [Source:UniProtKB/Swiss-Prot;Acc:Q8JHV6]
Human Orthologue:
LAMB4
Human Description:
laminin, beta 4 [Source:HGNC Symbol;Acc:6491]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4328 Nonsense Mutation detected in F1 DNA During 2014
sa6002 Nonsense Mutation detected in F1 DNA During 2014
sa9508 Nonsense Available for shipment Available now
sa24711 Nonsense Mutation detected in F1 DNA During 2014
sa6808 Nonsense Mutation detected in F1 DNA During 2014
sa18559 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058400 Nonsense 308 1827 8 35
ENSDART00000123330 Nonsense 308 1827 8 34
Genomic Location:
Chromosome 25 (position 32658740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGTGCATGGCAGATGTGTKTGTCAACACAACACTGCCGGGTACAACTG[T/A]GAGCGCTGTCAAGACTTTTACCATGACGCCCCCTGGAGGCCAGGTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058400 Nonsense 458 1827 11 35
ENSDART00000123330 Nonsense 458 1827 11 34
Genomic Location:
Chromosome 25 (position 32653180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTATTTATACATATCAAGTGTGCAGGTGTAATTTCCTGGGAACCAYA[C/T]AAGTGGGCAACCCTTGCGATCCGACAACAGGAAGGTGTATCTGTGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058400 Nonsense 670 1827 15 35
ENSDART00000123330 Nonsense 670 1827 15 34
Genomic Location:
Chromosome 25 (position 32644195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGACAATCCCCTTTGAACCAGGCTCACCTCTTCAGATCCTCCTGCGC[C/T]AACGTGCCAATGATCAGTCCATCACGTGGACTGGATTGGGTTTTGTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058400 Nonsense 894 1827 19 35
ENSDART00000123330 Nonsense 894 1827 19 34
Genomic Location:
Chromosome 25 (position 32640260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTATCGGCCGCTGCTGTGATTCTTGTGCTCCCCTGACATATGGGCTT[G/T]GACCCAATGGCTGCTCACGTAAGACATTTTCTCATATTTCTCATATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058400 Nonsense 973 1827 20 35
ENSDART00000123330 Nonsense 973 1827 20 34
Genomic Location:
Chromosome 25 (position 32633531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACCCCATCACTGGAGACTGTCTGGACTGCAGGGAACACTCCGCGGGA[C/T]GAAACTGCGAAAGGCAAGGGACGAGTCTGAGATCACATTTCAAGATTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058400 Nonsense 1226 1827 25 35
ENSDART00000123330 Nonsense 1226 1827 25 34
Genomic Location:
Chromosome 25 (position 32625748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTGACTGTAACYTGGAGGGCACCGTTCATCCAGCTTGTGACGCTTA[C/A]ACGGGTGAGTGTTTGTGTAAGCCAGGRGTGACRGGCCCTTTCTGTGATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2e66mamh