atp1a1a.3

Ensembl ID:
ENSDARG00000039131
ZFIN ID:
ZDB-GENE-001212-3
Description:
ATPase, Na+/K+ transporting, alpha 1a.3 polypeptide [Source:RefSeq peptide;Acc:NP_571763]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13779 Nonsense Available for shipment Available now
sa19400 Nonsense Mutation detected in F1 DNA During 2014
sa19401 Nonsense Mutation detected in F1 DNA During 2014
sa19402 Nonsense Mutation detected in F1 DNA During 2014
sa8642 Nonsense Mutation detected in F1 DNA During 2014
sa16341 Essential Splice Site Available for shipment Available now
sa6572 Nonsense Mutation detected in F1 DNA During 2014
sa9018 Nonsense Mutation detected in F1 DNA During 2014
sa18431 Essential Splice Site Available for shipment Available now
sa15962 Nonsense Available for shipment Available now
sa5932 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 25 1024 2 22
Genomic Location:
Chromosome 1 (position 1562361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGARTATAAGTTGGCGGCGACTTCAGAAGATGGAGTCAAAAMGCCTAAA[A/T]AAGGGAAAAAGAACAAAAAGGACATGGACGAACTGAAGAAAGAAGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 46 1024 3 22
Genomic Location:
Chromosome 1 (position 1563553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAATCTGAAAAACAAAAACTTCTCTACTCTTCTTCAGGATGATCAC[A/T]AACTGACATTGGAGGAGCTCAGCAGGAAATATGGAACTGATCTGAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 102 1024 4 22
Genomic Location:
Chromosome 1 (position 1563954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGACTCCAGAATGGGTGAAGTTCTGCAGGCAGCTCTTTGGTGGATTT[C/T]AGACTCTGCTGTGGATTGGTGCATTGCTCTGCTTCTTTGCATATTCGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 157 1024 5 22
Genomic Location:
Chromosome 1 (position 1564325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCACAGTCAATGGATGCTTCTCATACTATCAGGACGCAAAGAGCTCC[A/T]GAATCATGGATTCATTCAGGAACCTTGTTCCTCAGGTATAAAAATGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 161 1024 5 22
Genomic Location:
Chromosome 1 (position 1564338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATGCTTCTCATACTATCARGASGCAAAGWGCTCCAGAATCATGGATT[C/A]RTTCAGGAACCTTGTTCCTCAGGTATAAAAATGTAAATTCACTCTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 169 1024 6 22
Genomic Location:
Chromosome 1 (position 1564440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACANNATAGCTTTCACAACGAATAAATTCACRTAATTTATCATTATGC[A/T]GAAAGCCCTGGTTGTGCGTGAWGGAGAAAAAAGTGTRATMGATGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 460 1024 10 22
Genomic Location:
Chromosome 1 (position 1567646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGAGAGACACAGCTGGTGATGCCTCAGAGTCTGCGCTGCTSAAGTG[T/A]ATTGAGYTGTCTTGTGGYTCAGTTGCTGAAAYGAGAGAAAAYTACACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 862 1024 18 22
Genomic Location:
Chromosome 1 (position 1569507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTGTTTTTGTTCTTACATGTCTTCATGTTCATTTTCAGGCATGATA[C/T]AAGCAGTTGGYGGGTTCTTTACATACTTTGTGATTCTTGCTGAGAATGGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 907 1024 18 22
Genomic Location:
Chromosome 1 (position 1569645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAGACAGATTTCTTAATGACCTGGAAGACAGCTATGGCCAGCAATGG[G/T]TAGGTGCYACAGTTYTACCAAACCYAACAGAAATCAAACCAATATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 982 1024 20 22
Genomic Location:
Chromosome 1 (position 1571964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCWTTCCTGTCCTACTGCCCAGGCATGGAAGTTGCTGTCAGAATGTA[T/A]CCACTGAAGYGGGTGGAATCATACTAYATTTAATATGTYAAYAATGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 985 1024 20 22
Genomic Location:
Chromosome 1 (position 1571974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTACTGCCCAGGCATGGAAGTTGCTGTCAGAATGTATCCACTGAAG[T/C]GGGTGGAATCATACTAYATTTAATATGTTAATAATGTTAAGYRTTTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zek9qqp6