atp1a1a.3

Ensembl ID:
ENSDARG00000039131
ZFIN ID:
ZDB-GENE-001212-3
Description:
ATPase, Na+/K+ transporting, alpha 1a.3 polypeptide [Source:RefSeq peptide;Acc:NP_571763]
Human Orthologue:
ATP1A1
Human Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide [Source:HGNC Symbol;Acc:799]
Mouse Orthologue:
Atp1a1
Mouse Description:
ATPase, Na+/K+ transporting, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88105]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13779 Nonsense Available for shipment Available now
sa19400 Nonsense Available for shipment Available now
sa25506 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19401 Nonsense Available for shipment Available now
sa19402 Nonsense Available for shipment Available now
sa8642 Nonsense Mutation detected in F1 DNA During 2016
sa16341 Essential Splice Site Available for shipment Available now
sa6572 Nonsense Mutation detected in F1 DNA During 2016
sa9018 Nonsense Mutation detected in F1 DNA During 2016
sa18431 Essential Splice Site Available for shipment Available now
sa31188 Nonsense Available for shipment Available now
sa15962 Nonsense Available for shipment Available now
sa5932 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 25 1024 2 22
Genomic Location (Zv9):
Chromosome 1 (position 1562361)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1657781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGARTATAAGTTGGCGGCGACTTCAGAAGATGGAGTCAAAAMGCCTAAA[A/T]AAGGGAAAAAGAACAAAAAGGACATGGACGAACTGAAGAAAGAAGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 46 1024 3 22
Genomic Location (Zv9):
Chromosome 1 (position 1563553)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1658973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAATCTGAAAAACAAAAACTTCTCTACTCTTCTTCAGGATGATCAC[A/T]AACTGACATTGGAGGAGCTCAGCAGGAAATATGGAACTGATCTGAACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 62 1024 3 22
Genomic Location (Zv9):
Chromosome 1 (position 1563604)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1659024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGACATTGGAGGAGCTCAGCAGGAAATATGGAACTGATCTGAACAAG[G/A]TAGGTTTAATGACAATTTTGGTGTGAAATAATAATGATGATGATGACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 102 1024 4 22
Genomic Location (Zv9):
Chromosome 1 (position 1563954)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1659374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGACTCCAGAATGGGTGAAGTTCTGCAGGCAGCTCTTTGGTGGATTT[C/T]AGACTCTGCTGTGGATTGGTGCATTGCTCTGCTTCTTTGCATATTCGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 157 1024 5 22
Genomic Location (Zv9):
Chromosome 1 (position 1564325)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1659745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCACAGTCAATGGATGCTTCTCATACTATCAGGACGCAAAGAGCTCC[A/T]GAATCATGGATTCATTCAGGAACCTTGTTCCTCAGGTATAAAAATGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8642
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 161 1024 5 22
Genomic Location (Zv9):
Chromosome 1 (position 1564338)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1659758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATGCTTCTCATACTATCARGASGCAAAGWGCTCCAGAATCATGGATT[C/A]RTTCAGGAACCTTGTTCCTCAGGTATAAAAATGTAAATTCACTCTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 169 1024 6 22
Genomic Location (Zv9):
Chromosome 1 (position 1564440)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1659860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACANNATAGCTTTCACAACGAATAAATTCACRTAATTTATCATTATGC[A/T]GAAAGCCCTGGTTGTGCGTGAWGGAGAAAAAAGTGTRATMGATGCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 460 1024 10 22
Genomic Location (Zv9):
Chromosome 1 (position 1567646)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1663066
KASP Assay ID:
554-5187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGAGAGACACAGCTGGTGATGCCTCAGAGTCTGCGCTGCTSAAGTG[T/A]ATTGAGYTGTCTTGTGGYTCAGTTGCTGAAAYGAGAGAAAAYTACACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 862 1024 18 22
Genomic Location (Zv9):
Chromosome 1 (position 1569507)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1664927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTGTTTTTGTTCTTACATGTCTTCATGTTCATTTTCAGGCATGATA[C/T]AAGCAGTTGGYGGGTTCTTTACATACTTTGTGATTCTTGCTGAGAATGGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 907 1024 18 22
Genomic Location (Zv9):
Chromosome 1 (position 1569645)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1665065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAAGACAGATTTCTTAATGACCTGGAAGACAGCTATGGCCAGCAATGG[G/T]TAGGTGCYACAGTTYTACCAAACCYAACAGAAATCAAACCAATATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 941 1024 19 22
Genomic Location (Zv9):
Chromosome 1 (position 1569841)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1665261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCAGTATTGTGATTGTGCAGTGGACTGACCTGTTAATCTGCAAGACC[A/T]GAAGACTTTCCATCTTCCAGCAGGGAATGAAGTATGTTCACAATGGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Nonsense 982 1024 20 22
Genomic Location (Zv9):
Chromosome 1 (position 1571964)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1667384
KASP Assay ID:
2259-0061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCWTTCCTGTCCTACTGCCCAGGCATGGAAGTTGCTGTCAGAATGTA[T/A]CCACTGAAGYGGGTGGAATCATACTAYATTTAATATGTYAAYAATGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103850 Essential Splice Site 985 1024 20 22
Genomic Location (Zv9):
Chromosome 1 (position 1571974)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 1667394
KASP Assay ID:
554-3647.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTACTGCCCAGGCATGGAAGTTGCTGTCAGAATGTATCCACTGAAG[T/C]GGGTGGAATCATACTAYATTTAATATGTTAATAATGTTAAGYRTTTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link