cdkn3

Ensembl ID:
ENSDARG00000039130
ZFIN ID:
ZDB-GENE-060427-2
Description:
cyclin-dependent kinase inhibitor 3 [Source:RefSeq peptide;Acc:NP_001139153]
Human Orthologue:
CDKN3
Human Description:
cyclin-dependent kinase inhibitor 3 [Source:HGNC Symbol;Acc:1791]
Mouse Orthologue:
Cdkn3
Mouse Description:
cyclin-dependent kinase inhibitor 3 Gene [Source:MGI Symbol;Acc:MGI:1919641]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35556 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057155 Essential Splice Site 26 208 None 8

The following transcripts of ENSDARG00000039130 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37023301)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36495603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCAGTGTAATACTGCATAGACAGTGTAATCTGAGGTCTGTGTTTTGC[A/T]GGTTATCTCTGTCAATGGTGGAGTGCTCCCAGTCTCTTGGCATCTGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Dental caries: Genome-wide association scan of dental caries in the permanent dentition. (View Study)
  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link