map4k5

Ensembl ID:
ENSDARG00000039125
ZFIN ID:
ZDB-GENE-030131-6497
Description:
mitogen-activated protein kinase kinase kinase kinase 5 [Source:RefSeq peptide;Acc:NP_956207]
Human Orthologue:
MAP4K5
Human Description:
mitogen-activated protein kinase kinase kinase kinase 5 [Source:HGNC Symbol;Acc:6867]
Mouse Orthologue:
Map4k5
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1925503]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31950 Nonsense Available for shipment Available now
sa35558 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029824 Nonsense 354 878 15 33
ENSDART00000131534   None 162 None 9

The following transcripts of ENSDARG00000039125 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37131957)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36604259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCAGTTGATAAGCTTCAGTTTGAGCCCCCTTTAAGGAAAGAGACT[G/T]AAGCAAGTGCTGAGATGGTGAGCGAAACATCACATAGTCAAGATAATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029824 Nonsense 466 878 19 33
ENSDART00000131534   None 162 None 9

The following transcripts of ENSDARG00000039125 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 37126767)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36599069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCACACCTGAGAGAGGGAGTAACGCGGAGCACACCCATTCAGACTA[T/A]CTGTCTGTGAGCGTCAGCAGCCCTGGACTGCTCTCACACACCACAGACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link