nr5a5

Ensembl ID:
ENSDARG00000039116
ZFIN ID:
ZDB-GENE-030131-4652
Description:
nuclear receptor subfamily 5, group A, member 5 isoform 2 [Source:RefSeq peptide;Acc:NP_001070740]
Human Orthologues:
NR5A1, NR5A2
Human Descriptions:
nuclear receptor subfamily 5, group A, member 1 [Source:HGNC Symbol;Acc:7983]
nuclear receptor subfamily 5, group A, member 2 [Source:HGNC Symbol;Acc:7984]
Mouse Orthologues:
Nr5a1, Nr5a2
Mouse Descriptions:
nuclear receptor subfamily 5, group A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1346833]
nuclear receptor subfamily 5, group A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1346834]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33319 Nonsense Mutation detected in F1 DNA During 2017
sa11774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057123 Nonsense 35 511 2 7
ENSDART00000125515 Nonsense 61 537 2 7
ENSDART00000126244 Nonsense 61 229 2 5
ENSDART00000143096   None 213 None 2

The following transcripts of ENSDARG00000039116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 54102464)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53209779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGACTCAAGAAGAGGGCTGTCCTGTGTGTGGCGACAGGGTGTCTGGATA[T/G]CACTATGGTCTACTTACTTGTGAGAGTTGCAAGGTACGTGTCAAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057123 Nonsense 266 511 4 7
ENSDART00000125515 Nonsense 292 537 4 7
ENSDART00000126244   None 229 None 5
ENSDART00000143096 Nonsense 206 213 2 2

The following transcripts of ENSDARG00000039116 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 54099622)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53206937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACTCYGMGTTCCACCCCAACTCCATCACAGRGMTTGACCCCCACCT[C/A]AACYACAGCCCCAAGTTCCTTTTTYTTAAACCAGCTCCTGCAAGCCGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link