got1

Ensembl ID:
ENSDARG00000039093
ZFIN ID:
ZDB-GENE-040426-2003
Description:
aspartate aminotransferase, cytoplasmic [Source:RefSeq peptide;Acc:NP_998222]
Human Orthologue:
GOT1
Human Description:
glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Got1
Mouse Description:
glutamate oxaloacetate transaminase 1, soluble Gene [Source:MGI Symbol;Acc:MGI:95791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057090 Nonsense 43 176 2 4
Genomic Location:
Chromosome 13 (position 40789605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGAATGGTCATGGTGTTCCTCTCTTCAGCCTACAGGACAGATGAATG[T/A]CAGCCCTGGGTTCYCCCCGTGGTGAGGAAAGTGGAGAAGATGATCGCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vpsr0gk4