tyr

Ensembl ID:
ENSDARG00000039077
ZFIN IDs:
ZDB-GENE-991026-3, ZDB-GENE-991026-3
Description:
tyrosinase [Source:RefSeq peptide;Acc:NP_571088]
Human Orthologue:
TYR
Human Description:
tyrosinase (oculocutaneous albinism IA) [Source:HGNC Symbol;Acc:12442]
Mouse Orthologue:
Tyr
Mouse Description:
tyrosinase Gene [Source:MGI Symbol;Acc:MGI:98880]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3924 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057067 Nonsense 145 537 2 6
ENSDART00000122238 Nonsense 142 534 1 5
Genomic Location:
Chromosome 15 (position 42573025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTCCACTACCGAGAGGCAGAGGTTCATCTCGTACCTAAATCTGGCC[A/T]AAACCACCATAAGCCCCGATTATATGATCGTAACAGGAACGTACGCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Age-related macular degeneration: Insights into the genetic architecture of early stage age-related macular degeneration: a genome-wide association study meta-analysis. (View Study)
  • Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
  • Melanoma: Genome-wide association study identifies three loci associated with melanoma risk. (View Study)
  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)
  • Skin pigmentation: A genomewide association study of skin pigmentation in a South Asian population. (View Study)
  • Skin sensitivity to sun: Genetic determinants of hair, eye and skin pigmentation in Europeans. (View Study)
  • Tanning: Genome-wide association study of tanning phenotype in a population of European ancestry. (View Study)
  • Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)
  • Vitiligo: Variant of TYR and autoimmunity susceptibility loci in generalized vitiligo. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/61g70jye