im:7138239

Ensembl ID:
ENSDARG00000039070
ZFIN ID:
ZDB-GENE-081007-2
Description:
hypothetical protein LOC497366 [Source:RefSeq peptide;Acc:NP_991150]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6869 Nonsense Mutation detected in F1 DNA During 2014
sa17027 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057053 Nonsense 200 325 5 7
Genomic Location:
Chromosome 2 (position 54100053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRYATTAATAAMTAAACACGTATCTTTCATCTCACAGAGGGWTTTTCATG[T/A]GTCCCCACTAAGTTTGATTCCACCTTCATCSAAACTCCAAACAAAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057053 Nonsense 225 325 5 7
Genomic Location:
Chromosome 2 (position 54099978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAWCSAAACTCCAAACAAAGTGGAGCTGATCCAAACTGTGGCTCAAWG[C/A]AAACTAATARAGGGATGCTACCGAATGCCGTTAATGGAGTATCATTAYGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1e7l0yso