klhl31

Ensembl ID:
ENSDARG00000039066
ZFIN ID:
ZDB-GENE-030131-2052
Description:
Kelch-like protein 31 [Source:UniProtKB/Swiss-Prot;Acc:Q6Q7X9]
Human Orthologue:
KLHL31
Human Description:
kelch-like 31 (Drosophila) [Source:HGNC Symbol;Acc:21353]
Mouse Orthologue:
Klhl31
Mouse Description:
kelch-like 31 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045305]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38915 Nonsense Mutation detected in F1 DNA During 2016
sa16460 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057049 Nonsense 207 635 2 5
ENSDART00000102791 Nonsense 207 635 2 4
ENSDART00000124655 Nonsense 207 635 1 2
ENSDART00000129911 Nonsense 207 635 2 4
Genomic Location (Zv9):
Chromosome 13 (position 2123344)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2310630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCTCAGAAGTTCATGCGAGAGAACTTCATTGAGTTCTCCGAGATG[G/T]AGCAGTTCCTCAAACTCACCTACGAGCAAATCAACGAGTTCCTCACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057049 Nonsense 295 635 2 5
ENSDART00000102791 Nonsense 295 635 2 4
ENSDART00000124655 Nonsense 295 635 1 2
ENSDART00000129911 Nonsense 295 635 2 4
Genomic Location (Zv9):
Chromosome 13 (position 2123610)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2310364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGCAGGATGCCGAGTGCCACCGTTTGCTGGTCGACGCCATGAATTA[C/A]CACCTGCTGCCGTTCCAGCAGAACATCCTTCAATCCCGGAGGACCAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link