LOC559914

Ensembl ID:
ENSDARG00000039065
Mouse Orthologue:
Trpc2
Mouse Description:
transient receptor potential cation channel, subfamily C, member 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42607 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17854 Essential Splice Site Available for shipment Available now
sa35972 Nonsense Mutation detected in F1 DNA During 2016
sa11883 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006618 Essential Splice Site 239 801 2 12
Genomic Location (Zv9):
Chromosome 15 (position 37055948)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38455952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAAAAAAAAAAGTGTTATAGTGTTTTAACCTTTGTTCACTGATGTTC[A/C]GCCTCAGTATCTGGCTCTGGAGGAGCTGTGTCAGGAGTTTGCAGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006618 Essential Splice Site 362 801 4 12
Genomic Location (Zv9):
Chromosome 15 (position 37048741)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38448745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTTTAGTATTTTAATRTATAGTAATATAGTATCRCTTTTTCTGGCA[G/A]CTGGGTAAACTGCTAAAGGTTCCTGTGATYAAGTTCCTGTTGCACTCRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006618 Nonsense 437 801 5 12
Genomic Location (Zv9):
Chromosome 15 (position 37048425)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38448429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCTGGTTTGAGTGTAAGGAGGTCTGGATTGAGGGATTAAAGAGTTA[T/A]TTTCTGGATTTATGGAATATTCTGGATATGATGGTGTTGAGTATGTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006618 Nonsense 572 801 7 12
Genomic Location (Zv9):
Chromosome 15 (position 37047495)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38447499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAATAAACAACATATACGTCCCATATGTTATATCTCCACATCTTGGC[A/T]GGTGATTAATCWCTTGTTTACATAGAAATTCACCCAGRAGATCAATCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link