LOC559914

Ensembl ID:
ENSDARG00000039065
Mouse Orthologue:
Trpc2
Mouse Description:
transient receptor potential cation channel, subfamily C, member 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17854 Essential Splice Site Available for shipment Available now
sa11883 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006618 Essential Splice Site 362 801 4 12
Genomic Location:
Chromosome 15 (position 37048741)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTTTAGTATTTTAATRTATAGTAATATAGTATCRCTTTTTCTGGCA[G/A]CTGGGTAAACTGCTAAAGGTTCCTGTGATYAAGTTCCTGTTGCACTCRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006618 Nonsense 572 801 7 12
Genomic Location:
Chromosome 15 (position 37047495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAATAAACAACATATACGTCCCATATGTTATATCTCCACATCTTGGC[A/T]GGTGATTAATCWCTTGTTTACATAGAAATTCACCCAGRAGATCAATCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9vrvgjzo