kbtbd5

Ensembl ID:
ENSDARG00000039052
ZFIN ID:
ZDB-GENE-050916-1
Description:
kelch repeat and BTB (POZ) domain containing 5 [Source:RefSeq peptide;Acc:NP_001122154]
Human Orthologue:
KBTBD5
Human Description:
kelch repeat and BTB (POZ) domain containing 5 [Source:HGNC Symbol;Acc:30372]
Mouse Orthologue:
Kbtbd5
Mouse Description:
kelch repeat and BTB (POZ) domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1919580]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16343 Nonsense Available for shipment Available now
sa413 Nonsense Available for shipment Available now
sa25106 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057022 Nonsense 248 612 1 6
Genomic Location:
Chromosome 2 (position 21130350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACTTTAAAGAGAAAGTYGAGGGGCACCGATTGATTAGGACCAATCAG[G/T]AGCTCAAGAAGGAACTCCAGTTRATTAAGGWTGCACAGAAAGGWCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057022 Nonsense 481 612 4 6
Genomic Location:
Chromosome 2 (position 21124719)
KASP Assay ID:
554-0272.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATGTCTGAGGAGAGTGTGTGTCTACGACCCCTCGAAGTTTGAATGG[A/T]AGGATCTGGCACCTATGAAAACAGCCCGCTCTCTGTTCGGCACTGCTGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057022 Nonsense 549 612 5 6
Genomic Location:
Chromosome 2 (position 21123881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCCTCAGGAGAGAAGCTCTCTTAACCTGGTTGAACTTGGTGGCTTTT[T/A]ATACGCTATCGGTGGGTTTGCTATGATGCCTAATGAGACTACAGAAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ewyaucrw