hhatla

Ensembl ID:
ENSDARG00000039051
ZFIN ID:
ZDB-GENE-040426-1865
Description:
hedgehog acyltransferase-like, a [Source:RefSeq peptide;Acc:NP_957181]
Human Orthologue:
HHATL
Human Description:
hedgehog acyltransferase-like [Source:HGNC Symbol;Acc:13242]
Mouse Orthologue:
Hhatl
Mouse Description:
hedgehog acyltransferase-like Gene [Source:MGI Symbol;Acc:MGI:1922020]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16017 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057021 Essential Splice Site None 511 1 12
Genomic Location:
Chromosome 2 (position 21147924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCYGACATCTGCCTTCAAMCATCTGAGCGGCTGTRAAAGGCAGATACAAG[G/A]TTAGTACTGAGCAAGTGCACTTCCTTTTGATTTACTGTACTTACTGTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fxj35qs7