sfrp5

Ensembl ID:
ENSDARG00000039041
ZFIN ID:
ZDB-GENE-011108-2
Description:
secreted frizzled-related protein 5 [Source:RefSeq peptide;Acc:NP_571933]
Human Orthologue:
SFRP5
Human Description:
secreted frizzled-related protein 5 [Source:HGNC Symbol;Acc:10779]
Mouse Orthologue:
Sfrp5
Mouse Description:
secreted frizzled-related sequence protein 5 Gene [Source:MGI Symbol;Acc:MGI:1860298]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22366 Nonsense Available for shipment Available now
sa15896 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056996 Nonsense 63 310 1 3
ENSDART00000124746   None 129 1 4
Genomic Location (Zv9):
Chromosome 13 (position 40507166)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39821057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGCAGCCGCAGTGTGTGGATATCCCAGCCGACCTGCGGCTCTGCTA[C/A]AACGTGGGCTACAAAAAGATGCGCCTGCCAAACCTATTGGACCACGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056996 Essential Splice Site 201 310 2 3
ENSDART00000124746 Essential Splice Site 121 129 2 4
Genomic Location (Zv9):
Chromosome 13 (position 40486476)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 39800367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGTTGAAAGCCGACACCATAATGGAGCACTWCTGYGCCAGTGATTTTG[G/T]TAAGATATYAACTTTTATAGARACATTAAATTTGACAACTKAAATAACYR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link