fbxo5

Ensembl ID:
ENSDARG00000039020
ZFIN ID:
ZDB-GENE-030131-4027
Description:
F-box only protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q0V967]
Human Orthologue:
FBXO5
Human Description:
F-box protein 5 [Source:HGNC Symbol;Acc:13584]
Mouse Orthologue:
Fbxo5
Mouse Description:
F-box protein 5 Gene [Source:MGI Symbol;Acc:MGI:1914391]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4535 Nonsense Mutation detected in F1 DNA During 2014
sa8720 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18636 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 None None 384 1 6
ENSDART00000112924 Nonsense 45 182 1 5
ENSDART00000113450 Nonsense 27 346 1 7
Genomic Location:
Chromosome 13 (position 47400224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTGMGCTACCACTGCAATAGCGACAAGGGCGCGTTTATACGGACATA[T/A]GAGGACGACGTAAATATTSATTTTAACTTTTTAGAGGTAAGATAATAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site 80 384 None 6
ENSDART00000112924 Essential Splice Site 146 182 None 5
ENSDART00000113450 Essential Splice Site 128 346 None 7
Genomic Location:
Chromosome 13 (position 47403035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTACCAGAACAAGAGACATTCACTGGATATGGCATCAGATGATGAGG[T/C]GAAACGACAATCATTTTTAGCCGTGTGTACATGTKGGACGCRTGTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Nonsense 253 384 5 6
ENSDART00000112924 None None 182 None 5
ENSDART00000113450 Nonsense 301 346 5 7
Genomic Location:
Chromosome 13 (position 47410316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTCTCTTGGTTTCAGGACTCGGGCCGGTCTATGGGATCTTTATCT[C/T]GAGACTTCACCTTGGACAGGGTGGTGTTCTCCTGCATGCAGACMGTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ezmu4tnm