fbxo5

Ensembl ID:
ENSDARG00000039020
ZFIN ID:
ZDB-GENE-030131-4027
Description:
F-box only protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q0V967]
Human Orthologue:
FBXO5
Human Description:
F-box protein 5 [Source:HGNC Symbol;Acc:13584]
Mouse Orthologue:
Fbxo5
Mouse Description:
F-box protein 5 Gene [Source:MGI Symbol;Acc:MGI:1914391]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4535 Nonsense Mutation detected in F1 DNA During 2016
sa31965 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8720 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38972 Nonsense Mutation detected in F1 DNA During 2016
sa42299 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18636 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962   None 384 1 6
ENSDART00000112924 Nonsense 45 182 1 5
ENSDART00000113450 Nonsense 27 346 1 7
Genomic Location:
Chromosome 13 (position 47400224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTGMGCTACCACTGCAATAGCGACAAGGGCGCGTTTATACGGACATA[T/A]GAGGACGACGTAAATATTSATTTTAACTTTTTAGAGGTAAGATAATAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site None 384 None 6
ENSDART00000112924 Essential Splice Site 57 182 None 5
ENSDART00000113450 Essential Splice Site 39 346 None 7
Genomic Location:
Chromosome 13 (position 47400262)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACGGACATATGAGGACGACGTAAATATTGATTTTAACTTTTTAGAGG[T/A]AAGATAATAACGTTTTCCTGTCATATCCACGTATTTCCGTTAAAATTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site 80 384 None 6
ENSDART00000112924 Essential Splice Site 146 182 None 5
ENSDART00000113450 Essential Splice Site 128 346 None 7
Genomic Location:
Chromosome 13 (position 47403035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTACCAGAACAAGAGACATTCACTGGATATGGCATCAGATGATGAGG[T/C]GAAACGACAATCATTTTTAGCCGTGTGTACATGTKGGACGCRTGTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Nonsense 101 384 3 6
ENSDART00000112924 Nonsense 167 182 3 5
ENSDART00000113450 Nonsense 149 346 3 7
Genomic Location:
Chromosome 13 (position 47406081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCAGCGGCCTGACCGAAGACAGCGGTTACCTTTCCCTCCATAACAGC[C/T]AGGTGGACGTGGACGGACTGGACTCATTAGAGAGGAGTGAAGAGAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site 242 384 4 6
ENSDART00000112924   None 182 None 5
ENSDART00000113450 Essential Splice Site 290 346 4 7
Genomic Location:
Chromosome 13 (position 47408670)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCAGTTGGCTCTTCAGCGCTGGAAAAAAGCAGAAAAAACACGCAGGG[T/C]AAGAATGGATGAACGTAACCCACACATTGATTCACTTCTGTGACACTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Nonsense 253 384 5 6
ENSDART00000112924   None 182 None 5
ENSDART00000113450 Nonsense 301 346 5 7
Genomic Location:
Chromosome 13 (position 47410316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTCTCTTGGTTTCAGGACTCGGGCCGGTCTATGGGATCTTTATCT[C/T]GAGACTTCACCTTGGACAGGGTGGTGTTCTCCTGCATGCAGACMGTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link