eno3

Ensembl ID:
ENSDARG00000039007
ZFIN ID:
ZDB-GENE-031006-5
Description:
beta-enolase [Source:RefSeq peptide;Acc:NP_999888]
Human Orthologue:
ENO3
Human Description:
enolase 3 (beta, muscle) [Source:HGNC Symbol;Acc:3354]
Mouse Orthologue:
Eno3
Mouse Description:
enolase 3, beta muscle Gene [Source:MGI Symbol;Acc:MGI:95395]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14478 Nonsense Available for shipment Available now
sa4216 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013194 Nonsense 15 433 2 12
ENSDART00000076595 Nonsense 44 410 2 11
ENSDART00000132361 Nonsense 15 277 2 8
ENSDART00000136667 Nonsense 44 96 2 7
ENSDART00000145905 Nonsense 49 467 2 12
ENSDART00000147587 Nonsense 28 168 2 9

The following transcripts of ENSDARG00000039007 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 44730129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCAGGATGTCCATYAGTAAGATTCAYGCTCGTGAGWTCCTCGACTCC[A/T]GAGGAAACCCCACCGTTGAGGTCGACCTTTACACCACTAAAGGTAAAYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013194 Essential Splice Site 149 433 7 12
ENSDART00000076595 Essential Splice Site 126 410 6 11
ENSDART00000132361 Essential Splice Site 149 277 7 8
ENSDART00000136667 Essential Splice Site None 96 5 7
ENSDART00000145905 Essential Splice Site 183 467 7 12
ENSDART00000147587 None None 168 None 9

The following transcripts of ENSDARG00000039007 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 44734350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTTCTCTCYACATCTTATGATCCTTCTCTCCATCTCTCTCTCCTTCA[G/T]GCCTTTAATGTGATCAACGGCGGTTCTCACGCTGGTAATAAGCTGGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gvxqmirn