eno3

Ensembl ID:
ENSDARG00000039007
ZFIN ID:
ZDB-GENE-031006-5
Description:
beta-enolase [Source:RefSeq peptide;Acc:NP_999888]
Human Orthologue:
ENO3
Human Description:
enolase 3 (beta, muscle) [Source:HGNC Symbol;Acc:3354]
Mouse Orthologue:
Eno3
Mouse Description:
enolase 3, beta muscle Gene [Source:MGI Symbol;Acc:MGI:95395]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14478 Nonsense Available for shipment Available now
sa37797 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4216 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013194 Nonsense 15 433 2 12
ENSDART00000076595 Nonsense 44 410 2 11
ENSDART00000132361 Nonsense 15 277 2 8
ENSDART00000136667 Nonsense 44 96 2 7
ENSDART00000145905 Nonsense 49 467 2 12
ENSDART00000147587 Nonsense 28 168 2 9

The following transcripts of ENSDARG00000039007 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 44730129)
KASP Assay ID:
2261-8259.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCAGGATGTCCATYAGTAAGATTCAYGCTCGTGAGWTCCTCGACTCC[A/T]GAGGAAACCCCACCGTTGAGGTCGACCTTTACACCACTAAAGGTAAAYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013194   None 433 None 12
ENSDART00000076595   None 410 None 11
ENSDART00000132361   None 277 None 8
ENSDART00000136667 Essential Splice Site 93 96 3 7
ENSDART00000145905   None 467 None 12
ENSDART00000147587   None 168 None 9

The following transcripts of ENSDARG00000039007 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 44730433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCGTGATGGAGACAAAACGCGCTACCTGGGAAAAGGTACACGAGGA[C/T]ACACACAAGTTCAAATTGCCTTATTGACTATAGTAAAAGCCACACATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013194 Essential Splice Site 149 433 7 12
ENSDART00000076595 Essential Splice Site 126 410 6 11
ENSDART00000132361 Essential Splice Site 149 277 7 8
ENSDART00000136667 Essential Splice Site None 96 5 7
ENSDART00000145905 Essential Splice Site 183 467 7 12
ENSDART00000147587   None 168 None 9

The following transcripts of ENSDARG00000039007 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 44734350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTTCTCTCYACATCTTATGATCCTTCTCTCCATCTCTCTCTCCTTCA[G/T]GCCTTTAATGTGATCAACGGCGGTTCTCACGCTGGTAATAAGCTGGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link