FIG4 (1 of 2)

Ensembl ID:
ENSDARG00000039004
Description:
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) [Source:HGNC Symbol;Acc:16873
Human Orthologue:
FIG4
Human Description:
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) [Source:HGNC Symbol;Acc:16873
Mouse Orthologue:
Fig4
Mouse Description:
FIG4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143585]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23824 Nonsense Mutation detected in F1 DNA During 2014
sa10829 Splice Site, Nonsense Available for shipment Available now
sa15712 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Nonsense 47 403 3 11
Genomic Location:
Chromosome 20 (position 53404492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGTTTGTATGAGCTGACCATATAAAATCTGTCTGTGTTGTTTAGGTG[G/A]GGAGATCTTGGAGGAACCGTCACACCTAATGGACGCTTACAGGTACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Splice Site, Nonsense 61 403 3 11
Genomic Location:
Chromosome 20 (position 53404532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTAGGTGGGGAGATCTTGGAGGAACCGTCACACCTAATGGACGCTTA[C/T]AGGTACACCAAYACTACACTGTAYACTTTCCTGATGYTAAAATAGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Nonsense 349 403 10 11
Genomic Location:
Chromosome 20 (position 53445392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGARGAGCAGATCTCCAGCAGCTCTGAAGACGACAGTGAAGACGAT[C/T]GAGAAGACGACGCCAGCGCCTCGCAGAGATCCACACCKATCAGACTGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/keceaxa7