LOC100329385

Ensembl ID:
ENSDARG00000038996
Human Orthologue:
EGLN1
Human Description:
egl nine homolog 1 (C. elegans) [Source:HGNC Symbol;Acc:1232]
Mouse Orthologue:
Egln1
Mouse Description:
EGL nine homolog 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1932286]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22384 Nonsense Mutation detected in F1 DNA During 2016
sa11386 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056927 Nonsense 55 328 1 5
Genomic Location (Zv9):
Chromosome 13 (position 50154393)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48885431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCAAAGAGCATCAAAAGGAGCACTGGAAAAAGCACAAACTCACCTGC[A/T]GAGAGGCTGACAAACACAACACTGTGCCCCAAACCCAACAACAGCACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056927 Nonsense 234 328 2 5
Genomic Location (Zv9):
Chromosome 13 (position 50173249)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48904287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGGAYAACCCGAATGGCGATGGGAGATGCGTCACGTRCATTTATTA[T/A]CTTAATAAGAATTGGGATGCCAAGGYATGCAAGAAATCACAGATGYYATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link