LOC100329385

Ensembl ID:
ENSDARG00000038996
Human Orthologue:
EGLN1
Human Description:
egl nine homolog 1 (C. elegans) [Source:HGNC Symbol;Acc:1232]
Mouse Orthologue:
Egln1
Mouse Description:
EGL nine homolog 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1932286]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22384 Nonsense Mutation detected in F1 DNA During 2014
sa11386 Nonsense Available for shipment Available now
sa3854 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056927 Nonsense 55 328 1 5
Genomic Location:
Chromosome 13 (position 50154393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCAAAGAGCATCAAAAGGAGCACTGGAAAAAGCACAAACTCACCTGC[A/T]GAGAGGCTGACAAACACAACACTGTGCCCCAAACCCAACAACAGCACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056927 Nonsense 234 328 2 5
Genomic Location:
Chromosome 13 (position 50173249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGGAYAACCCGAATGGCGATGGGAGATGCGTCACGTRCATTTATTA[T/A]CTTAATAAGAATTGGGATGCCAAGGYATGCAAGAAATCACAGATGYYATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056927 Essential Splice Site 242 328 2 5
Genomic Location:
Chromosome 13 (position 50173275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATGCGTCACGTGCATTTATTATCTTAATAAGAATTGGGATGCCAAGG[T/C]ATGCAAGAAATCACAGATGTTATTTAATCCTCAAAGCTTCGACCTGNAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lq81dvqc