nsfb

Ensembl ID:
ENSDARG00000038991
ZFIN ID:
ZDB-GENE-050808-1
Description:
N-ethylmaleimide-sensitive factor b [Source:RefSeq peptide;Acc:NP_001019625]
Human Orthologue:
NSF
Human Description:
N-ethylmaleimide-sensitive factor [Source:HGNC Symbol;Acc:8016]
Mouse Orthologue:
Nsf
Mouse Description:
N-ethylmaleimide sensitive fusion protein Gene [Source:MGI Symbol;Acc:MGI:104560]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22087 Nonsense Available for shipment Available now
sa10323 Nonsense Available for shipment Available now
sa42023 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42022 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056919 Nonsense 247 747 8 21
Genomic Location (Zv9):
Chromosome 12 (position 23701619)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22224781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCGTCGGGCTTTTGCTTCACGAGTCTTTCCTCCAGACATAGTAGAA[C/T]AAATGGGTGAGTCTTTGATTTTGACTGGCTGTATCACTTTAAAAACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056919 Nonsense 294 747 9 21
Genomic Location (Zv9):
Chromosome 12 (position 23695181)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22218343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGCCAGAGAGCCAAAAGTGGTCAAMGGGCCAGAGATTYTGAACAAATA[C/A]GTGGGAGAATCGGAGGCCAACATCAGAAAGCTATTCGCTGATGCTGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056919 Essential Splice Site 315 747 9 21
Genomic Location (Zv9):
Chromosome 12 (position 23695116)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22218278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAACATCAGAAAGCTATTCGCTGATGCTGAGGAGGAACAGAAGAGGG[T/C]ACGAAACCAGAGATGGCATTTTGTGCAAATTATTCAACACATTGCACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056919 Essential Splice Site 542 747 14 21
Genomic Location (Zv9):
Chromosome 12 (position 23688378)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22211540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGACCAAGAACAGTGAACGCACACCCCTAGTTACTGTTCTATTAGAGG[G/A]CAAGTCTTATACAAACAAACACAAATACAGTGTTAGCTAACTGAAACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link