DPYSL2 (1 of 2)

Ensembl ID:
ENSDARG00000038974
Description:
dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
Human Orthologue:
DPYSL2
Human Description:
dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
Mouse Orthologue:
Dpysl2
Mouse Description:
dihydropyrimidinase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1349763]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7118 Nonsense Mutation detected in F1 DNA During 2017
sa34289 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2444 Essential Splice Site F2 line generated During 2017
sa5769 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa7118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Nonsense 168 573 5 14
Genomic Location (Zv9):
Chromosome 8 (position 5362588)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5296750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCTNTTTTTTTTTTTTTTTACAGGYGTCAACTYTTTTCTGGTCTA[T/A]CTGGCGTACAAAGACATCTTCCAGCTCAATGATTCCCAGGTAAACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
Genomic Location (Zv9):
Chromosome 8 (position 5342554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5315983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/T]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2444
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
Genomic Location (Zv9):
Chromosome 8 (position 5342554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5315983
KASP Assay ID:
554-3062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/A]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5769
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
Genomic Location (Zv9):
Chromosome 8 (position 5342554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5315983
KASP Assay ID:
554-3062.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/A]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link