cul3a

Ensembl ID:
ENSDARG00000038967
ZFIN IDs:
ZDB-GENE-030131-3376, ZDB-GENE-081007-1
Description:
cullin-3 [Source:RefSeq peptide;Acc:NP_955985]
Human Orthologue:
CUL3
Human Description:
cullin 3 [Source:HGNC Symbol;Acc:2553]
Mouse Orthologue:
Cul3
Mouse Description:
cullin 3 Gene [Source:MGI Symbol;Acc:MGI:1347360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056882 Nonsense 432 766 9 16
Genomic Location:
Chromosome 2 (position 47779678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTTCAGGTTCATGCAGGAGAAGGATGTGTTCGAACGTTACTACAAA[C/T]AGCATCTGGCCAGAAGGCTTTTAACCAATAAGAGCGTTTCAGATGACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ykdyd6lh