traf4b

Ensembl ID:
ENSDARG00000038964
ZFIN ID:
ZDB-GENE-040305-2
Description:
tnf receptor-associated factor 4b [Source:RefSeq peptide;Acc:NP_997982]
Human Orthologue:
TRAF4
Human Description:
TNF receptor-associated factor 4 [Source:HGNC Symbol;Acc:12034]
Mouse Orthologue:
Traf4
Mouse Description:
TNF receptor associated factor 4 Gene [Source:MGI Symbol;Acc:MGI:1202880]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13894 Nonsense Available for shipment Available now
sa24012 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056878 Nonsense 63 478 2 7
Genomic Location:
Chromosome 21 (position 37853172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATAGTGAAGGAGTGTTCACATGCCCAGAAGACCAGCTGCCACTRGATTA[T/G]GCAAARGTGAGTACTCATTAAAAATAGYGCTGTRCAAAGATGAATCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056878 Essential Splice Site 208 478 5 7
Genomic Location:
Chromosome 21 (position 37843950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCCTTGCAGATACTGCAAAAAAGAGTTCCTCTATGACACTATTCAGG[T/C]CAGTGCACTATATACTCTACCATCCTACTTCTGCAACATTTATTTACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lhvg5znd