LOC565210

Ensembl ID:
ENSDARG00000038957
Human Orthologue:
FLVCR2
Human Description:
feline leukemia virus subgroup C cellular receptor family, member 2 [Source:HGNC Symbol;Acc:20105]
Mouse Orthologue:
Mfsd7c
Mouse Description:
major facilitator superfamily domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2384974]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23195 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056869 Nonsense 419 441 9 9
Genomic Location (Zv9):
Chromosome 17 (position 52451128)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51835783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTTGATGTCTGTCTTCCTCACAGCGTTCATAAAGTCTGACCTGCGG[C/T]GACAGAAGGCCAACCAGGAGACCGGGGGCAATGCCGTGAGTGTGTTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link