LOC565210

Ensembl ID:
ENSDARG00000038957
Human Orthologue:
FLVCR2
Human Description:
feline leukemia virus subgroup C cellular receptor family, member 2 [Source:HGNC Symbol;Acc:20105]
Mouse Orthologue:
Mfsd7c
Mouse Description:
major facilitator superfamily domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2384974]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3986 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4730 Nonsense Mutation detected in F1 DNA During 2014
sa23195 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056869 Essential Splice Site 197 441 3 9
Genomic Location:
Chromosome 17 (position 52438055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATATTTGGATCTGTATTTGCCCGTGTTTGAATGACCGTGTGTCTCA[G/A]TGTTTCAGGAGAAACCCGAAACACCKCCATCTCTGGCTCAGGTCGCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056869 Nonsense 324 441 6 9
Genomic Location:
Chromosome 17 (position 52447160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCTTCTGTCATTCGTGGGGATGCTGATCTACTCCTTCACTCTGAACT[T/A]GGGTCATTTGTGGCTCGTGTTCCTCACGTCAGGGGTGCTGGGGTAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056869 Nonsense 419 441 9 9
Genomic Location:
Chromosome 17 (position 52451128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTTGATGTCTGTCTTCCTCACAGCGTTCATAAAGTCTGACCTGCGG[C/T]GACAGAAGGCCAACCAGGAGACCGGGGGCAATGCCGTGAGTGTGTTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j9n2ja6d