fdx1b

Ensembl ID:
ENSDARG00000038956
ZFIN ID:
ZDB-GENE-060526-382
Description:
ferredoxin 1b [Source:RefSeq peptide;Acc:NP_001094419]
Human Orthologue:
FDX1
Human Description:
ferredoxin 1 [Source:HGNC Symbol;Acc:3638]
Mouse Orthologue:
Fdx1
Mouse Description:
ferredoxin 1 Gene [Source:MGI Symbol;Acc:MGI:103224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31429 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056867 Nonsense 126 132 4 4
ENSDART00000131223   None 168 5 5
Genomic Location (Zv9):
Chromosome 5 (position 24009870)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21722742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATAATAACTATATACAGCATAACAAAAACAGTACTTTTACTTAGGAT[T/G]AAACAATGGACAAATTTGTTTTCATCTTGTTCTATTCTGATTACATATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link