ppp1r1c

Ensembl ID:
ENSDARG00000038941
ZFIN ID:
ZDB-GENE-040718-273
Description:
protein phosphatase 1 regulatory subunit 1C [Source:RefSeq peptide;Acc:NP_001002538]
Human Orthologue:
PPP1R1C
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 1C [Source:HGNC Symbol;Acc:14940]
Mouse Orthologue:
Ppp1r1c
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 1C Gene [Source:MGI Symbol;Acc:MGI:1923185]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21588 Essential Splice Site Available for shipment Available now
sa21589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056846 Essential Splice Site None 171 1 7
Genomic Location (Zv9):
Chromosome 9 (position 45497368)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44629303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACCTGCAGTCATCTCTGCCGCTGGGACGTTTATGGGACACTGCGAA[G/A]TGAGTGGGACAGCATGGATGGATGTGGGAAGGACAGACTGGTTGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056846 Nonsense 7 171 2 7
Genomic Location (Zv9):
Chromosome 9 (position 45497604)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44629539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCTCTCTCCGACAGTTCTCTCGTTCAGCATGGAGCCCAACAGCCCC[A/T]AGAAGATTCAGTTTGCCGTTCCACTTTTCCAGAGCCAGTTGGATCCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link