drd1

Ensembl ID:
ENSDARG00000038918
ZFIN ID:
ZDB-GENE-070524-2
Description:
D(1A) dopamine receptor [Source:RefSeq peptide;Acc:NP_001129448]
Human Orthologue:
DRD1
Human Description:
dopamine receptor D1 [Source:HGNC Symbol;Acc:3020]
Mouse Orthologue:
Drd1a
Mouse Description:
dopamine receptor D1A Gene [Source:MGI Symbol;Acc:MGI:99578]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41558 Nonsense Mutation detected in F1 DNA During 2017
sa16476 Nonsense Available for shipment Available now
sa16418 Nonsense Available for shipment Available now
sa21616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056810 Nonsense 163 446 2 2
Genomic Location (Zv9):
Chromosome 9 (position 56504496)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54917886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGCTGTCCATCCTTATCTCCTTCATCCCTGTGCAGCTAAATTGGCAC[A/T]AAGCCCAGACGACTAGTTATACAGAGCTTAACGGTACCTATGGCGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056810 Nonsense 314 446 2 2
ENSDART00000056810 Nonsense 314 446 2 2
Genomic Location (Zv9):
Chromosome 9 (position 56504950)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54918340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACTGACTTCTTGTGCATCAGYTCCACCACATTTGATGTGTTTGTTT[G/A]GTTCGGTTGGGCGAACTCATCACTCAACCCCATCATCTATGCCTTCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056810 Nonsense 314 446 2 2
ENSDART00000056810 Nonsense 314 446 2 2
Genomic Location (Zv9):
Chromosome 9 (position 56504950)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54918340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACTGACTTCTTGTGCATCAGYTCCACCACATTTGATGTGTTTGTTT[G/A]GTTCGGTTGGGCGAACTCATCACTCAACCCCATCATCTATGCCTTCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056810 Nonsense 370 446 2 2
Genomic Location (Zv9):
Chromosome 9 (position 56505119)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54918509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTGTGAGTATCAACAACAACTGTGGCCCTCCGTCTACTTCTCAGTA[T/A]CAGCCTAAGGGCCACATTCCCAAGGAGGGCAACAACAGCAACTATGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link