im:6906849

Ensembl ID:
ENSDARG00000038917
ZFIN IDs:
ZDB-GENE-050506-110, ZDB-GENE-050506-110
Description:
Im:6906849 protein [Source:UniProtKB/TrEMBL;Acc:Q6DGC5]
Human Orthologue:
RAD50
Human Description:
RAD50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:9816]
Mouse Orthologue:
Rad50
Mouse Description:
RAD50 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:109292]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27506 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41557 Nonsense Mutation detected in F1 DNA During 2017
sa34791 Nonsense Mutation detected in F1 DNA During 2017
sa34790 Nonsense Available for shipment Available now
sa34789 Nonsense Mutation detected in F1 DNA During 2017
sa34788 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927   None 1312 None 25
ENSDART00000121721 Essential Splice Site None 409 1 11
Genomic Location (Zv9):
Chromosome 9 (position 56447729)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54861119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGAAGCACGTCAGTGCGCCGACGCGGGAAACACACGTCTTGGTTCATG[T/G]AAGTCCTGTAAGCTTGAGTTCAAGGGAAACTTGCTTCATTGTTTTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 385 1312 8 25
ENSDART00000121721 Nonsense 385 409 9 11
Genomic Location (Zv9):
Chromosome 9 (position 56436301)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54849691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCCAGGTAAAGACTTTGGCGTCTTTCCTGGAGTTGGAGGGCTATGAT[C/T]GAACGCCACTTAGTGAGCGACAACTCCAAAGCTTTTACAGACAAATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 562 1312 11 25
ENSDART00000121721   None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56431873)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54845263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGACAAAGAGGAGCAGGTGAGGAAGATCAAGTCGAGACATAATGAA[G/T]AGCTGGTGTCTCTGCTGGGACACTTTCCAAACAAGAAAGAGCTGGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 606 1312 12 25
ENSDART00000121721   None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56429077)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54842467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTAACAATTTGTTTTGTTTTTGTAGTAAAGAGCTTGCATCTGGAGAA[C/T]AGAAGAAGAGTCATTACACTGCAGAAATCAAACGAAAAGAAGAGCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 716 1312 13 25
ENSDART00000121721   None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56426646)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54840036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACATGCAGTCCAAACTGCGGCTTGTCCCAGACAAGCTGAAGAATACG[G/T]AGCATGACTTGAAGAGGAAGGAGCGCAGACGTGATGAAATGATGACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Essential Splice Site 1130 1312 21 25
ENSDART00000121721   None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56415911)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54829301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAGCTGGCCAATAAAGACCTGGACATCTACTATAAAGCCCTAGACCA[G/A]TAAGCTGATTTTATTATCAGGGGGTTTCTAATGGGTAGAGTCAGGTAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study of asthma identifies RAD50-IL13 and HLA-DR/DQ regions. (View Study)
  • IgE levels : Genome-wide scan on total serum IgE levels identifies FCER1A as novel susceptibility locus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link