hectd3

Ensembl ID:
ENSDARG00000038905
ZFIN ID:
ZDB-GENE-031118-179
Description:
HECT domain containing 3 [Source:RefSeq peptide;Acc:NP_001070627]
Human Orthologue:
HECTD3
Human Description:
HECT domain containing 3 [Source:HGNC Symbol;Acc:26117]
Mouse Orthologue:
Hectd3
Mouse Description:
HECT domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1923858]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19769 Essential Splice Site Available for shipment Available now
sa19770 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8608 Nonsense Mutation detected in F1 DNA During 2014
sa11205 Nonsense Available for shipment Available now
sa6012 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 287 854 5 21
ENSDART00000144837 Essential Splice Site 287 854 5 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26631425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGACAGCACTGGATCCGTCTGCACATGAGGAGAGGCACTGTGGTCAA[G/A]TAAGGACGACTGGTCTGCTAGCGACTGTAATTAAAAAGGACTTTTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 408 854 9 21
ENSDART00000144837 Essential Splice Site 408 854 9 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26634874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTTAGTGGCACTCAGTGTTTTTTTTTTATGTGTGTGCATGTCTGT[A/C]GGTTCATCACACTTCTGGACAGTCTATTGCCTCATATGGTGCCTGCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 433 854 9 21
ENSDART00000144837 Nonsense 433 854 9 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26634949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGCCTCATATGGTGCCTGCATGGGACTACAGTCTGGGAACATTCAAC[C/T]AGATCAAAGTYAGTACTCTTGTCTTGAGCAAATTTGTCCTATGSCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 494 854 10 21
ENSDART00000144837 Nonsense 494 854 10 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26636437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACCGGGACAATCCCACTCTRGATGTCACATGCAAAAATGCWGTTT[T/G]AACTCAGGTAGTCCACAAAATATGTACAGTAGATTTGTGNNNTTTTTTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Splice Site, Nonsense 752 854 18 21
ENSDART00000144837 Splice Site, Nonsense 752 854 18 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26642482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGGAACSCTGRTATTAATATTAATGTTAATCAATCTTTCTATCAGCA[C/T]GATAYGAAGACTTGGAGCAAACAGATGTCAGAGTGCAGTACTTATGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u9vmnmii