hectd3

Ensembl ID:
ENSDARG00000038905
ZFIN ID:
ZDB-GENE-031118-179
Description:
HECT domain containing 3 [Source:RefSeq peptide;Acc:NP_001070627]
Human Orthologue:
HECTD3
Human Description:
HECT domain containing 3 [Source:HGNC Symbol;Acc:26117]
Mouse Orthologue:
Hectd3
Mouse Description:
HECT domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1923858]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32927 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa19769 Essential Splice Site Available for shipment Available now
sa25817 Nonsense Mutation detected in F1 DNA During 2016
sa19770 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8608 Nonsense Mutation detected in F1 DNA During 2016
sa11205 Nonsense Available for shipment Available now
sa6012 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 201 854 3 21
ENSDART00000144837 Missense 201 854 3 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26629610)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26825806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAACCCAAGGTGGCAGAGGCGGATGAGGCTGCTGTTCGAAAGTTGAG[G/T]CAAGTGAAAACTTTGACCGAAACATTTCAATCTGTAATAGAATGTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 287 854 5 21
ENSDART00000144837 Essential Splice Site 287 854 5 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26631425)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26827621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGACAGCACTGGATCCGTCTGCACATGAGGAGAGGCACTGTGGTCAA[G/A]TAAGGACGACTGGTCTGCTAGCGACTGTAATTAAAAAGGACTTTTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 369 854 8 21
ENSDART00000144837 Nonsense 369 854 8 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26634667)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26830863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGGGAATCGACGTACGGATCAGGGGTCTAAAGATCAAATCGTCCTG[C/A]GAACGTGACTTGGGCCTGAATGCAGATGTGTTCCAATCTCCCAATCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 408 854 9 21
ENSDART00000144837 Essential Splice Site 408 854 9 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26634874)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26831070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTTAGTGGCACTCAGTGTTTTTTTTTTATGTGTGTGCATGTCTGT[A/C]GGTTCATCACACTTCTGGACAGTCTATTGCCTCATATGGTGCCTGCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 433 854 9 21
ENSDART00000144837 Nonsense 433 854 9 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26634949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26831145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGCCTCATATGGTGCCTGCATGGGACTACAGTCTGGGAACATTCAAC[C/T]AGATCAAAGTYAGTACTCTTGTCTTGAGCAAATTTGTCCTATGSCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 494 854 10 21
ENSDART00000144837 Nonsense 494 854 10 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26636437)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26832633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACCGGGACAATCCCACTCTRGATGTCACATGCAAAAATGCWGTTT[T/G]AACTCAGGTAGTCCACAAAATATGTACAGTAGATTTGTGNNNTTTTTTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Splice Site, Nonsense 752 854 18 21
ENSDART00000144837 Splice Site, Nonsense 752 854 18 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26642482)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26838678
KASP Assay ID:
554-3900.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGGAACSCTGRTATTAATATTAATGTTAATCAATCTTTCTATCAGCA[C/T]GATAYGAAGACTTGGAGCAAACAGATGTCAGAGTGCAGTACTTATGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link