acadm

Ensembl ID:
ENSDARG00000038900
ZFIN ID:
ZDB-GENE-040426-1945
Description:
medium-chain specific acyl-CoA dehydrogenase, mitochondrial isoform 2 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
ACADM
Human Description:
acyl-CoA dehydrogenase, C-4 to C-12 straight chain [Source:HGNC Symbol;Acc:89]
Mouse Orthologue:
Acadm
Mouse Description:
acyl-Coenzyme A dehydrogenase, medium chain Gene [Source:MGI Symbol;Acc:MGI:87867]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6844 Nonsense Mutation detected in F1 DNA During 2014
sa6011 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9731 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Nonsense 85 424 4 12
ENSDART00000132125 Nonsense 87 426 4 12
ENSDART00000145262 Nonsense 83 248 4 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26623247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGATTTTTCTCTTTSCAGTATCCTTTCCCCCTTATTAAGAGAGCAT[G/A]GGAGCTGGGTCTAATGAACGGACATATTCCAGAGGACTGTGGTAAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Essential Splice Site 239 424 8 12
ENSDART00000132125 Essential Splice Site 241 426 8 12
ENSDART00000145262 Essential Splice Site 237 248 8 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26620815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTTCATTGTAGATGCTGATACCCCAGGAGTCCAGCCTGGCAGAAAGG[T/A]AAAGGCTGGTGACAGTCGTATTTGTGTCCCAAACTGCTAAAAACACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Essential Splice Site 286 424 9 12
ENSDART00000132125 Essential Splice Site 288 426 9 12
ENSDART00000145262 None None 248 None 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 26619208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGGCTTTAAGATTGCCATGGGTGCATTTGACAAGACYAGACCACCAG[T/C]AAGTGTTATTGCTTATAAAGTGCAGATGTCTGCTTCATCCCGCKTCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kzcowszv