tmx3

Ensembl ID:
ENSDARG00000038894
ZFIN ID:
ZDB-GENE-050522-396
Description:
thioredoxin-related transmembrane protein 3 [Source:RefSeq peptide;Acc:NP_001018393]
Human Orthologue:
TMX3
Human Description:
thioredoxin-related transmembrane protein 3 [Source:HGNC Symbol;Acc:24718]
Mouse Orthologue:
Tmx3
Mouse Description:
thioredoxin-related transmembrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:2442418]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11147 Essential Splice Site Available for shipment Available now
sa19775 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9830 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 26 434 2 16
ENSDART00000137053 Essential Splice Site 29 157 3 8
ENSDART00000145835 Essential Splice Site 29 437 2 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 27477096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCAGCCATTGCTTTGGTGTCAGGATACGTGGAGGAGCTCGATGACAA[G/A]TAAGTATTTTAYAATGTAAGCAAAAGGAATATAGTTTAATAGTTAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 40 434 4 16
ENSDART00000137053 Essential Splice Site 43 157 5 8
ENSDART00000145835 Essential Splice Site 43 437 4 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 27475795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTTTGGTGTTATGCCATCTGTGAAATAATGATGTCTTATAATTGCA[G/A]TTTTATGCTCCATGGTGCGCGTACTGCCACACATTTGAGCCAGTATGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 275 434 12 16
ENSDART00000137053 None None 157 None 8
ENSDART00000145835 Essential Splice Site 278 437 12 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 27467618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTCTGATGGAAAGGGTGTCTACAGAATACAGAGACCATTATAAAAG[G/A]TAAGAAGCACATTTATATGAACAAAAACAGCATGAAGAGTTATTTCTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4n9i0ykc