ift80

Ensembl ID:
ENSDARG00000038879
ZFIN ID:
ZDB-GENE-041212-50
Description:
intraflagellar transport protein 80 homolog [Source:RefSeq peptide;Acc:NP_001008625]
Human Orthologues:
IFT80, RP11-432B6.3
Human Descriptions:
intraflagellar transport 80 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:29262]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J614]
Mouse Orthologue:
Ift80
Mouse Description:
intraflagellar transport 80 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1915509]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35783 Nonsense Mutation detected in F1 DNA During 2016
sa35782 Nonsense Mutation detected in F1 DNA During 2016
sa35781 Nonsense Available for shipment Available now
sa13176 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 3 777 2 20
ENSDART00000133943 Nonsense 3 777 2 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1529072)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1568957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGACATTACCAGAGTAAAACACCAGAGGAGACGCTGAAGGATGCGAT[T/A]GAAAACATCGTTGCTGAAGGAGCCCAAACATATCCTTTAAATTACTGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 400 777 12 20
ENSDART00000133943 Nonsense 400 777 12 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1501705)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1541590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACACTTTCTGTTGGTGGATGGAGCGGAGGTGTATGTGTACTCGTAT[G/T]AGGGTCGTCTGATTTCATCCCCCAAGAGTCCCGGCATGAGAATGGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 438 777 12 20
ENSDART00000133943 Nonsense 438 777 12 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1501591)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1541476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCTCGCTGAGCAACGACACCATCGCTATACGGGACACCACTGATGAA[C/T]GAGGTGCAGATTTACAGTACTGCATGCATGACTGGAGTGTATACTGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Essential Splice Site 612 777 16 20
ENSDART00000133943 Essential Splice Site 612 777 16 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1494893)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1534778
KASP Assay ID:
2260-8033.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCAYTCACTATAYCCTTGTTCAGTCACGACGTATGGAAAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link