ift80

Ensembl ID:
ENSDARG00000038879
ZFIN ID:
ZDB-GENE-041212-50
Description:
intraflagellar transport protein 80 homolog [Source:RefSeq peptide;Acc:NP_001008625]
Human Orthologues:
IFT80, RP11-432B6.3
Human Descriptions:
intraflagellar transport 80 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:29262]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J614]
Mouse Orthologue:
Ift80
Mouse Description:
intraflagellar transport 80 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1915509]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13176 Essential Splice Site Available for shipment Available now
sa3912 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Essential Splice Site 612 777 16 20
ENSDART00000133943 Essential Splice Site 612 777 16 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 1494893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCAYTCACTATAYCCTTGTTCAGTCACGACGTATGGAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Essential Splice Site 612 777 16 20
ENSDART00000133943 Essential Splice Site 612 777 16 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 1494893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCAYTCACTATACCCTTGTTCAGTCACGACGTATGGAAAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o74wtt7j