ENSDARG00000038872

Ensembl ID:
ENSDARG00000038872
Human Orthologue:
ZBED1
Human Description:
zinc finger, BED-type containing 1 [Source:HGNC Symbol;Acc:447]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7099 Nonsense Mutation detected in F1 DNA During 2016
sa34222 Nonsense Mutation detected in F1 DNA During 2016
sa41066 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061380 Nonsense 241 524 2 3
ENSDART00000121413 Nonsense 228 511 3 4
Genomic Location (Zv9):
Chromosome 7 (position 65802089)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58983829
KASP Assay ID:
554-4905.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCACAGAAGSCCCTAAATTTACCAGTACATTCCCTCATATCAGAATGY[C/T]AAACAAGATGGGGTTCCAGACAGATGATGATCAGCAGRATTTTAGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061380 Nonsense 284 524 2 3
ENSDART00000121413 Nonsense 271 511 3 4
Genomic Location (Zv9):
Chromosome 7 (position 65801959)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58983699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAAGAAGGCAAGGCATCTGATTCAAACCTGGCAAGATATAGATGTCT[T/A]GGAATCTGTCAGCAAGACACTGGGCCCACTACTGGATTTCACAGATGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061380 Nonsense 311 524 2 3
ENSDART00000121413 Nonsense 298 511 3 4
Genomic Location (Zv9):
Chromosome 7 (position 65801877)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58983617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATTTCACAGATGCACTCTCAGGAGAAGATTATGTTAGTGTCTCCTA[T/A]GTGAAGCCAGTTCTTCACCTCTTCAACACTTCAATGCTATTAACGCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link