ENSDARG00000038872

Ensembl ID:
ENSDARG00000038872
Human Orthologue:
ZBED1
Human Description:
zinc finger, BED-type containing 1 [Source:HGNC Symbol;Acc:447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7099 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061380 Nonsense 241 524 2 3
ENSDART00000121413 Nonsense 228 511 3 4
Genomic Location:
Chromosome 7 (position 65802089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCACAGAAGSCCCTAAATTTACCAGTACATTCCCTCATATCAGAATGY[C/T]AAACAAGATGGGGTTCCAGACAGATGATGATCAGCAGRATTTTAGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/384fsb4w