shhb

Ensembl ID:
ENSDARG00000038867
ZFIN ID:
ZDB-GENE-980526-41
Description:
Tiggy-winkle hedgehog proteinTiggy-winkle hedgehog protein N-productTiggy-winkle hedgehog protein C-
Human Orthologue:
SHH
Human Description:
sonic hedgehog [Source:HGNC Symbol;Acc:10848]
Mouse Orthologue:
Shh
Mouse Description:
sonic hedgehog Gene [Source:MGI Symbol;Acc:MGI:98297]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8431 Nonsense Mutation detected in F1 DNA During 2017
sa2069 Nonsense F2 line generated During 2017
sa5719 Nonsense F2 line generated During 2017
sa25111 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056747 Nonsense 77 416 1 3
Genomic Location (Zv9):
Chromosome 2 (position 29769823)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30071458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCAGCGGCAAWTACGAAGGCAAAATCACAAGGAATTCAGAGAGATTT[A/T]AAGAGCTGATTCCGAATTATAATCCCGATATCATCTTTAAGGACGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2069
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056747 Nonsense 266 416 3 3
ENSDART00000056747 Nonsense 266 416 3 3
Genomic Location (Zv9):
Chromosome 2 (position 29766383)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30068018
KASP Assay ID:
554-3388.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAACGAGAAGGCAATTCATCGTCATCGAGACGTCAGAACCTTTCACC[A/T]AGCTCACCCTCACTGCCGCGCACCTAGTTTTCGTTGGAAACTCTTCWGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5719
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056747 Nonsense 266 416 3 3
ENSDART00000056747 Nonsense 266 416 3 3
Genomic Location (Zv9):
Chromosome 2 (position 29766383)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30068018
KASP Assay ID:
554-3388.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAACGAGAAGGCAATTCATCGTCATCGAGACGTCAGAACCTTTCACC[A/T]AGCTCACCCTCACTGCCGCGCACCTAGTTTTCGTTGGAAACTCTTCWGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056747 Nonsense 364 416 3 3
Genomic Location (Zv9):
Chromosome 2 (position 29766088)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30067723
KASP Assay ID:
554-7612.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCATTGAGAACCACAAATGGGCACATTGGGCTTTTGCGCCGGTCAGGT[T/A]GTGTCACAAGCTGATGACGTGGCTTTTTCCGGCTCGTGAATCAAACGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link