LOC570167

Ensembl ID:
ENSDARG00000038866
Human Orthologue:
TRAPPC8
Human Description:
trafficking protein particle complex 8 [Source:HGNC Symbol;Acc:29169]
Mouse Orthologue:
D030074E01Rik
Mouse Description:
RIKEN cDNA D030074E01 gene Gene [Source:MGI Symbol;Acc:MGI:2443008]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10799 Nonsense Available for shipment Available now
sa6613 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077095 Nonsense 759 1478 16 30
Genomic Location:
Chromosome 20 (position 6437641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCGCCGCAGCAAACAGGGGAAGCRTTCCCAACACCTTCCAGCCATCC[C/T]AGTGCTGCCTGAACAGCCAGACGGACAACCTCCGATATCCACTCGCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077095 Essential Splice Site 833 1478 17 30
Genomic Location:
Chromosome 20 (position 6431163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGGAGAAACCATCAGCAATGAGAAAGAGGCAGYGGCTCTRAAAGAAG[T/C]AAGGCYGTTAATCGTCTCTCAGTTCATCGTCCCCGAGGYGTCCGGCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jumt42to