bre

Ensembl ID:
ENSDARG00000038863
ZFIN ID:
ZDB-GENE-050417-299
Description:
BRCA1-A complex subunit BRE [Source:UniProtKB/Swiss-Prot;Acc:Q568D5]
Human Orthologue:
BRE
Human Description:
brain and reproductive organ-expressed (TNFRSF1A modulator) [Source:HGNC Symbol;Acc:1106]
Mouse Orthologue:
Bre
Mouse Description:
brain and reproductive organ-expressed protein Gene [Source:MGI Symbol;Acc:MGI:1333875]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23156 Nonsense Available for shipment Available now
sa28910 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14574 Nonsense Available for shipment Available now
sa36490 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056742 Nonsense 37 386 2 12
ENSDART00000137091 Nonsense 37 71 2 3
ENSDART00000143714 Nonsense 37 71 2 3
Genomic Location (Zv9):
Chromosome 17 (position 41243802)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41129430
KASP Assay ID:
2261-1435.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTCTATAGTGAGGAATGGACGGGTTGGTTTGGATTCATCCAGCTG[T/A]CTCCGGATTACTGACCTCAAGAGTGGGTGAGTGTTCTGTGAACTCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056742 Essential Splice Site 46 386 2 12
ENSDART00000137091 Essential Splice Site 46 71 2 3
ENSDART00000143714 Essential Splice Site 46 71 2 3
Genomic Location (Zv9):
Chromosome 17 (position 41243830)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41129458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTTTGGATTCATCCAGCTGTCTCCGGATTACTGACCTCAAGAGTGGG[T/G]GAGTGTTCTGTGAACTCTACAAAAAATAGATAACTTTTGGAGAACAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056742 Nonsense 334 386 11 12
ENSDART00000137091   None 71 None 3
ENSDART00000143714   None 71 None 3
Genomic Location (Zv9):
Chromosome 17 (position 41418901)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41304529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTGTACTTCCCTCGAGATCAGCCCACCCTGACGTTTCAGTCCATCTA[T/G]CACTTCACCAGCAGTGGRCAGCTCTACTCTCAGGTGCAAAAATCCTACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056742 Nonsense 356 386 11 12
ENSDART00000137091   None 71 None 3
ENSDART00000143714   None 71 None 3
Genomic Location (Zv9):
Chromosome 17 (position 41418966)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41304594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCAGCTCTACTCTCAGGTGCAAAAATCCTACCCCTACAGTCCACGCT[G/A]GGATGGGAACGAGATGGCCAAACGAGCCAAGTAAGAGCAAATGAATAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link