kcnb2

Ensembl ID:
ENSDARG00000038862
ZFIN ID:
ZDB-GENE-070912-170
Description:
Novel protein similar to vertebrate potassium voltage-gated channel, Shab-related subfamily, member
Human Orthologue:
KCNB2
Human Description:
potassium voltage-gated channel, Shab-related subfamily, member 2 [Source:HGNC Symbol;Acc:6232]
Mouse Orthologue:
AC132603.1
Mouse Description:
potassium voltage-gated channel subfamily B member 2 [Source:RefSeq peptide;Acc:NP_001091998]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19785 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129365 Nonsense 179 824 2 3
ENSDART00000130344   None 102 None 2
Genomic Location (Zv9):
Chromosome 2 (position 29862872)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30164507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGATCAGGTGGACACAGGCTGCTGTCCAGACAAAAGGCAGAAGCTCTG[G/A]GATTTGCTGGAGAAACCGAGCTCTTCAGTGGCTGCCAAGGTAAGATGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link