rgs20

Ensembl ID:
ENSDARG00000038859
ZFIN ID:
ZDB-GENE-040718-128
Description:
regulator of G-protein signaling 20 [Source:RefSeq peptide;Acc:NP_001002431]
Human Orthologue:
RGS20
Human Description:
regulator of G-protein signaling 20 [Source:HGNC Symbol;Acc:14600]
Mouse Orthologue:
Rgs20
Mouse Description:
regulator of G-protein signaling 20 Gene [Source:MGI Symbol;Acc:MGI:1929866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30597 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056735   None 225 1 5
ENSDART00000124666 Nonsense 51 293 1 5
ENSDART00000131230   None 221 None 5
ENSDART00000147355   None 147 1 4
Genomic Location (Zv9):
Chromosome 2 (position 30498878)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30800513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCCAGGCCTGTCGGCACGACGAGGGTTACTTCGCCAACGGAAGTTA[T/A]GAAAATGAGGACGAGAACGAAAATACGGAGGATGGATCAAAGGATCCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link