si:dkey-216e9.3

Ensembl ID:
ENSDARG00000038855
ZFIN ID:
ZDB-GENE-060503-60
Human Orthologue:
CHMP5
Human Description:
chromatin modifying protein 5 [Source:HGNC Symbol;Acc:26942]
Mouse Orthologue:
Chmp5
Mouse Description:
chromatin modifying protein 5 Gene [Source:MGI Symbol;Acc:MGI:1924209]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa717 Nonsense Available for shipment Available now
sa39848 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9007 Nonsense Mutation detected in F1 DNA During 2017
sa32944 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056731 Nonsense 14 251 1 8
ENSDART00000132645   None 219 None 8
Genomic Location (Zv9):
Chromosome 2 (position 30609471)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30911106
KASP Assay ID:
554-0625.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTATTATGGTGTGTATTCCACGACCAACCGGAAGAAGCGCGTTGTG[G/A]TGGTCGGCATTTAAATACCTCTACAAAGCAAATAAGTGTCATTCCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056731 Essential Splice Site 105 251 3 8
ENSDART00000132645 Essential Splice Site 73 219 3 8
Genomic Location (Zv9):
Chromosome 2 (position 30611724)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30913359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATACAGTGAAGCAGAAGGCAATGAGAGTGCTGAAACAGAAGAGAATG[T/A]GAGTTTGTTTGGAGACTAATGTGCATTTACAATGTATGAAATGTTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056731 Nonsense 125 251 4 8
ENSDART00000132645 Nonsense 93 219 4 8
Genomic Location (Zv9):
Chromosome 2 (position 30611949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30913584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAGATCAACTTTCTCAACAGTCTTTTAATATGGAACAAGCYAACTA[T/A]ACAATCCAGTCTTTAAGGGACACCAAAACAACAGTAAAGACTTGTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056731 Nonsense 134 251 4 8
ENSDART00000132645 Nonsense 102 219 4 8
Genomic Location (Zv9):
Chromosome 2 (position 30611974)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30913609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTAATATGGAACAAGCCAACTATACAATCCAGTCTTTAAGGGACACC[A/T]AAACAACAGTAAAGACTTGTTATTTTACATTACATCTGTCATTATTACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link