ldhd

Ensembl ID:
ENSDARG00000038845
ZFIN ID:
ZDB-GENE-030131-6140
Description:
probable D-lactate dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_956167]
Human Orthologue:
LDHD
Human Description:
lactate dehydrogenase D [Source:HGNC Symbol;Acc:19708]
Mouse Orthologue:
Ldhd
Mouse Description:
lactate dehydrogenase D Gene [Source:MGI Symbol;Acc:MGI:106428]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19359 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15623 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056721 Essential Splice Site 66 497 2 11
Genomic Location:
Chromosome 25 (position 13922249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGTTCTGCTGTCAGAGAGCAGCATGGCAGAGATGAGTCTGTGCACAG[G/A]TGGGTTGTCTCTGCCATGCCCGAGTGCCACCTGCTTCCTAATGATATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056721 Essential Splice Site 113 497 3 11
Genomic Location:
Chromosome 25 (position 13920446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATTCGGCACAGGGACGGGCTTGGAGGGAGGTGTTRGTGCTCTRCAGG[T/G]TGGTMCAGTAAAGAAAAAGAGAAAGCAGAATATTACTCTGAAAATGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3h8nh4l8