jph1b

Ensembl ID:
ENSDARG00000038826
ZFIN ID:
ZDB-GENE-060616-389
Description:
junctophilin 1b [Source:RefSeq peptide;Acc:NP_001037813]
Human Orthologue:
JPH1
Human Description:
junctophilin 1 [Source:HGNC Symbol;Acc:14201]
Mouse Orthologue:
Jph1
Mouse Description:
junctophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1891495]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13453 Nonsense Available for shipment Available now
sa2064 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa13453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099078 Nonsense 106 673 1 6

The following transcripts of ENSDARG00000038826 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 30038553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAAGGGTCGCTACGGGGTTCGCCAGAGCCTCAATACACCTGCCAGGTA[T/A]GAAGGCACATGGAGTAATGGACTGCAAGACGGATATGGGGTCGWGACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2064
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099078 Essential Splice Site 127 673 1 6

The following transcripts of ENSDARG00000038826 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 30038490)
KASP Assay ID:
554-3325.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAATGGACTGCAAGACGGATATGGGGTCGAGACGTACGGGGATGGGGG[T/C]GAGTTCAGCCAAACATCACTTGACCTATTTAGTGTTCTTTAAAGTCTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/42vxu64q