mrc1b

Ensembl ID:
ENSDARG00000038822
ZFIN ID:
ZDB-GENE-070705-13
Description:
Novel protein similar to human and mouse mannose receptor, C type 1 (MRC1) [Source:UniProtKB/TrEMBL;
Human Orthologues:
MRC1, MRC1L1
Human Descriptions:
mannose receptor, C type 1 [Source:HGNC Symbol;Acc:7228]
mannose receptor, C type 1-like 1 [Source:HGNC Symbol;Acc:23403]
Mouse Orthologue:
Mrc1
Mouse Description:
mannose receptor, C type 1 Gene [Source:MGI Symbol;Acc:MGI:97142]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18640 Nonsense Available for shipment Available now
sa16104 Nonsense Available for shipment Available now
sa8087 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Nonsense 254 1426 4 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 Nonsense 106 815 2 19
Genomic Location:
Chromosome 2 (position 31252771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCTGTCAGCAGCAAGGCGCTGAATTGCTGAGCATATCTGAACCTCAC[G/T]AACAATCCTTCATAGCARGTATGCGCAATTATCAAAATATTCTCTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Nonsense 584 1426 11 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 None 429 815 9 19
Genomic Location:
Chromosome 2 (position 31245141)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCAACACTAAGCAAGTCCCATTCACTCACTTCAACTCTGGGATGCCA[G/T]GTATTATGTTAAAAACWTTATGACAATAGATTGAAGAGRATTCTTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Nonsense 606 1426 12 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 Nonsense 451 815 10 19
Genomic Location:
Chromosome 2 (position 31244965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCAATGACGACTGGAATAGTTGCTGGGCTTTGGGATGTGCTTAGCTG[T/A]TCAAATAAGGAAAAATACATCTGCAAGCAAAGAGCTGATGCTCTAGTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/699la2qq