myrip

Ensembl ID:
ENSDARG00000038814
ZFIN ID:
ZDB-GENE-080123-1
Description:
A kinase-anchoring protein [Source:UniProtKB/TrEMBL;Acc:A8T6P4]
Human Orthologue:
MLPH
Human Description:
melanophilin [Source:HGNC Symbol;Acc:29643]
Mouse Orthologue:
Mlph
Mouse Description:
melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5076 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14099 Nonsense Available for shipment Available now
sa7514 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082301 Essential Splice Site 216 838 5 11
ENSDART00000113420 Essential Splice Site 216 1118 5 15
ENSDART00000137257 Essential Splice Site 216 300 5 7
Genomic Location:
Chromosome 24 (position 10928359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGATAGAGGAAGCTATTGCTAAAGCGGAGAACTACAAAGACAGTCTGG[T/A]AACAMATTATTCTTTATTTATTATTCATCCAACCACYAATTTATCTTTCK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082301 Nonsense 830 838 10 11
ENSDART00000113420 Nonsense 830 1118 10 15
ENSDART00000137257 None None 300 None 7
Genomic Location:
Chromosome 24 (position 10913520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACAAGAGAGACAATCAGAGATTGAGCGAGACTTAGAAAAGAAAAGG[A/T]AAAGCATACGAATGGAAAAAGAGAAATTAGTGAGTGKGAAATCCAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082301 None None 838 None 11
ENSDART00000113420 Missense 938 1118 11 15
ENSDART00000137257 None None 300 None 7

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 24 (position 10899687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTGGATGTGGAGCAGAAGTAYTCTGCTGCGTCTTTATGCAGCATCA[C/T]CACAGAGGTTCTGAAGGTCCTAAACGCCACAGAGGATTTGCTTGGTGARG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o906olbw