klhl20

Ensembl ID:
ENSDARG00000038801
ZFIN ID:
ZDB-GENE-040426-1935
Description:
kelch-like protein 20 [Source:RefSeq peptide;Acc:NP_998166]
Human Orthologue:
KLHL20
Human Description:
kelch-like 20 (Drosophila) [Source:HGNC Symbol;Acc:25056]
Mouse Orthologue:
Klhl20
Mouse Description:
kelch-like 20 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444855]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9448 Nonsense Available for shipment Available now
sa8539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056666 Nonsense 286 591 6 12
ENSDART00000111099 Nonsense 208 513 5 11
ENSDART00000146624 Nonsense 208 513 5 11
ENSDART00000056666 Nonsense 286 591 6 12
ENSDART00000111099 Nonsense 208 513 5 11
ENSDART00000146624 Nonsense 208 513 5 11
Genomic Location:
Chromosome 2 (position 33837321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATGAAGCCAAGAATTACCTCCTGCTGCCCCAAGAGCGCCCCCTAATG[C/T]AGGGACCTCGTACCCGCYCTMGAAAGCCTATTCGTTGTGGAGAAGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056666 Nonsense 286 591 6 12
ENSDART00000111099 Nonsense 208 513 5 11
ENSDART00000146624 Nonsense 208 513 5 11
ENSDART00000056666 Nonsense 286 591 6 12
ENSDART00000111099 Nonsense 208 513 5 11
ENSDART00000146624 Nonsense 208 513 5 11
Genomic Location:
Chromosome 2 (position 33837321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATGAAGCCAAGAATTACCTCCTGCTGCCCCAAGAGCGCCCCCTAATG[C/T]AGGGACCTCGTACCCGCYCTMGAAAGCCTATTCGTTGTGGAGAAGTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i2t16j14