ccdc24

Ensembl ID:
ENSDARG00000038793
ZFIN ID:
ZDB-GENE-050327-18
Description:
coiled-coil domain-containing protein 24 [Source:RefSeq peptide;Acc:NP_001014330]
Human Orthologue:
CCDC24
Human Description:
coiled-coil domain containing 24 [Source:HGNC Symbol;Acc:28688]
Mouse Orthologue:
Ccdc24
Mouse Description:
coiled-coil domain containing 24 Gene [Source:MGI Symbol;Acc:MGI:2685874]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32956 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056656 Essential Splice Site 203 229 None 7
ENSDART00000114573 Essential Splice Site 203 397 None 8
ENSDART00000132221 Missense 204 210 6 6
ENSDART00000134024 Essential Splice Site 203 280 None 8
Genomic Location (Zv9):
Chromosome 2 (position 33152553)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33451460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGACTGAAGAATCTGAAGCTTTGAGAAAAGATGTGCAGGCCTTGCAGG[T/C]AAGGGCTTATTTTGACGTTAATTACTGGTTTTGATTGCAACATCGATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link