abcf2

Ensembl ID:
ENSDARG00000038785
ZFIN ID:
ZDB-GENE-030131-8714
Description:
ATP-binding cassette, sub-family F (GCN20), member 2 [Source:RefSeq peptide;Acc:NP_958472]
Human Orthologue:
ABCF2
Human Description:
ATP-binding cassette, sub-family F (GCN20), member 2 [Source:HGNC Symbol;Acc:71]
Mouse Orthologue:
Abcf2
Mouse Description:
ATP-binding cassette, sub-family F (GCN20), member 2 Gene [Source:MGI Symbol;Acc:MGI:1351657]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39862 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39862
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056640 Nonsense 575 613 14 15
Genomic Location (Zv9):
Chromosome 2 (position 32224074)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32522981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGAGGGTGGAATGATGCTGGTCAGCCACGACTTTAGGCTAATTCAG[C/T]AGGTAATGTAATTCTCCTGTTTGTCACATTTAGATGATCTGTGTAAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link