mrpl12

Ensembl ID:
ENSDARG00000038768
ZFIN ID:
ZDB-GENE-050417-187
Description:
39S ribosomal protein L12, mitochondrial [Source:RefSeq peptide;Acc:NP_001017696]
Human Orthologue:
SLC25A10
Human Description:
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10 [Source:HGNC
Mouse Orthologue:
Slc25a10
Mouse Description:
solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10 Gene [Source:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17861 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056618 None None 194 None 5
ENSDART00000109544 Essential Splice Site 334 412 11 14
Genomic Location:
Chromosome 3 (position 47729730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGATGACTGACAACATCYTCACTCACTTTGTTGCCAGTTTCATTGCGG[T/A]AAGTTATCCTCCTTTCCAAAAACCATTATTATTYTTAAGCTGTTTGTTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o5g91ke5